[PCR]#15 Human DNA extraction and Amplification

관리자
8 Nov 2021
Views 2317

Contents

1.Introduction 

2.Materials and equipment 

3. Procedure 

4. Results 

5. Precautions 

1. Introduction


1. Introduction

DNA extraction can be performed on various samples such as human oral epithelial cells, hair roots, and urine to learn the basic extraction process and amplification principle of DNA.

The extracted DNA is amplified using 16SrRNA, which has a very conservative base sequence in the human mitochondria, and the results are confirmed through electrophoresis experiments.

2. Materials and equipment


2. Materials and equipment 

  • Materials

-Sample Preparation solution

-2X PCR Master mix

-16SrRNA Forward primer (CAATTGGACCAATCTATCACC:21mer)

-16SrRNA Reverse primer (GTGAGGGTAATAATGACTTGT:21mer)

-Extracted DNA

-Positive DNA

-D.W

-50bp DNA Ladder


  • Instruments and Devices 

- Conventional PCR → DuxCycler (BIOMEDUX. Co. Ltd., South Korea)

- Electrophoresis → Power Supply  (BIO-RAD Laboratories. Inc., USA)

- Gel –tray (BIONEER Cooperation, South Korea )

- Gel image processing device →  DuxGeldoc ( BIOMEDUX, Co. Ltd. South Korea)

- Heat block →  Allsheng Instrument (BIOAND Cooperation: South Korea )

3. Procedure


3. Procedure 

<Specimen sampling >

Oral epithelial cells: Row and hang-out the mouth strongly with saline solution for about 1minute, collect and extract oral epithelial cells and then soak in 1 mL tube.

 

Hair roots: Pull out a few strands of hair and collect only the hair roots on the tube.

Urine: Take urine in a collection cup and put it in 1mL tube.


<DNA extraction>

1. After centrifuging at the maximum speed of the centrifuge for 1 minute, the supernatant is discarded with only a slight solution left. (In the case of hair roots, this process is omitted)

2. Add 50uL. of sample pretreatment solution and mix it for several seconds through a vortex mixer.

3. After dropping the sample along the tube wall to the floor with a centrifuge, treat with 95℃, for 10 minutes through a hot block or PCR device.

4. After centrifuging the treated sample at the maximum speed of the centrifuge for 1minute, the supernatant is transferred into a new tube (If the last process is too cumbersome, you can skip centrifugation, and use a little bit of the sample).


<DNA amplification>

1. Sample preparation

No.ReagentsTube 1Tube 2 (Positive control)Tube 3 (Negative control)
12X PCR Master mix10uL10uL10uL
2Forward primer1uL1uL1uL
3Reverse primer1uL1uL1uL
4Extracted DNA3uL--
5Positive DNA-3uL-
6D.W.5uL5uL8uL
Total
20uL20uL20uL


2. PCR conditions

ProcessingTemperatureTime(min)Cycles
Pre-denaturation95℃5:001
Denaturation95℃0:2030
Annealing54℃0:20
Extension72℃0:30
Final extension72℃5:001

4℃


<Electrophoresis>

1. Install the prepared agarose gel in the electrophoresis tank containing the TEA or TBE buffer solution.

2. Mix 5㎕of the extracted DNA product and 1㎕of 6X loading dye strongly and injected in to the injection well of the agarose gel by micropipette.

3. A commercialized DNA size marker(DNA Ladder) is injected into one well so that the size of the DNA band can be checked inversely

4. Connected power supply and the electricity at 250v, in the ⊝→⊕. Direction (If the DNA band is dragged to about 2/3 of gel’s total length, it stops)..

5.  The electrophoresis gel is treated with nucleic acid stain solution (When using Loading Star, it is electrophoresis by mixing it with amplification product and injecting it into an agarose gel well, so this step could be omitted).

 (Usually, it is left in an Et Br solution for about 20 minutes, but since EtBr is harmful to the human body, it is recommended to use an alternative product (Recommended product: Loading Star (Manufacturer Dyna Bio)

 6. Check the band using the GelDoc system.

4. Results


4. Results

12243f806afe3.png\

-M: 50bp Ladder

-1~5: Extracted DNA (16SrRNA: 157bp) in urine.

-6~10: Extracted DNA of hair roots

-11~15: Extracted DNA from oral epithelial cells

-P: Positive Control

-N: Negative Control

*Since the amount of DNA extracted varies from person to person, the thickness of the band may vary from sample to sample.

5. Precautions


5. Precautions 

Band formation in negative control: Disinfect experimental tools and tables to remove pollutants.

Forming a band in the wrong ‘position’; Since it is a wrong experiment, A new experiment proceeds again.


#Conventional PCR #16SrRNA gene #Oral epithelial cells



180fbb278da97.png


The human DNA extraction amplification experiment is done in this experiment used the PCR kit for education by BIOMEDUX Co. Ltd.

1 0