1. Introduction
1. Introduction
1) Genomic DNA is extracted from clinical samples using DNA extraction kits (without reagents)
2) Target DNA for two pathogens of the urogenital infectious disease is amplified from DNA extracted using this diagnostic kit. Whenever the test is conducted, the positive and negative controls for the quality management are amplified to check for contamination.
3) Electrophoresis the amplified PCR result to confirm the amplified result.
3) The results is confirmed that the negative control does not amplify, and if a band of same size as positive control is identified as an amplified result. And then, the pathogen infection shall be confirmed
4) It determines whether a pathogen is detected. At this time, the determination of the detection of pathogens is made for each of two types of pathogens.
2. Materials and equipment
2. Materials and equipment
Materials
PCR Premix, Primer mix, Distilled water(DNase free)
HSV1 Forward: ATCCTCGCTTTAGGAACAACT
HSV1 Reverse: CCAACTGCCCCCTTATCTA
HSV2 Forward: CGAAGACAGCTGCGTTCCC
HSV2 Reverse: TTCGCTTCATCGCCACGAAG
Equipment
Conventional PCR (ex.Veriti® Thermal Cycler -> Applied Biosystems, USA)
DNA Electrophoresis (ex.MyGeldoc -> LabGenomics Co., South Korea )
3. Procedure
3. Procedure
3.1. DNA extraction
① Extract total DNA from human origin using a DNA extraction kit.
② The Extracted DNA can be used immediately for the PCR, in case of long-term preservation, should be keep into the freezer under the –20℃
③ The concentration of the extracted DNA shall be from 5 to 100 ng/uL, and a sample with a purity of 1.6 to 2.0 at the A260/A280 ratio was used.
3.2. PCR reaction process for two types of virus reaction
① Prepare a PCR mixture. The PCR mixed solution is prepared by mixing each reagent with the composition of following table based on one sample. At this time, the amount of each reagent used should be calculated according to the number of reactions of the sample including the control (positive controls and negative controls) group.
| Reagent added | amount (for one sample) |
|---|
| PCR Premix | 10 uL |
| Primer mix | 4 uL |
| D.W | 3 uL |
| Total | 17 uL |
② the prepared PCR mixture is lightly mixed about 5 times, or vortexed, and then centrifuged lightly.
③ Pour the PCR mixture 17 uL in to the PCR tube(after pouring, immediately close the lid to prevent contamination).
④ Template DNA 3 uL extracted from clinical samples, is added into the tube (positive control DNA provided in the positive control tube and DW in the negative control tube).
| Reagent added | amount (for one sample) |
|---|
| PCR mixture | 17 uL |
| Template | 3 uL |
| Total | 20 uL |
⑤ Each mixed solution tube is centrifuged for 30 seconds and the put into a PCR device to react as follows.
| Processing | Temperature | Time (min.) | Cycles |
|---|
| UDG-treatment | 37℃ | 02:00 | 1 |
| Pre-Denaturation | 95℃ | 02:00 | 1 |
Denaturation
| 95℃ | 00:30 | 40 |
| Annealing | 57℃ | 00:40 |
| Extension | 72℃ | 01:00 |
| Final-Extension | 72℃ | 05:00 | 1 |
| End | 4℃ | ∞ |
|
4. Results
4. Results


5. Precautions
5. Precautions
① Pay attention to pipetting so that DNA or PCR reagents do not contaminated during the experiment.
② Be careful not to make mistake in temperature and/or reagent amount during the experimental method.

Contents
1.Introduction
2.Materials and equipment
3. Procedure
4. Results
5. Precautions
1. Introduction
1. Introduction
1) Genomic DNA is extracted from clinical samples using DNA extraction kits (without reagents)
2) Target DNA for two pathogens of the urogenital infectious disease is amplified from DNA extracted using this diagnostic kit. Whenever the test is conducted, the positive and negative controls for the quality management are amplified to check for contamination.
3) Electrophoresis the amplified PCR result to confirm the amplified result.
3) The results is confirmed that the negative control does not amplify, and if a band of same size as positive control is identified as an amplified result. And then, the pathogen infection shall be confirmed
4) It determines whether a pathogen is detected. At this time, the determination of the detection of pathogens is made for each of two types of pathogens.
2. Materials and equipment
2. Materials and equipment
Materials
PCR Premix, Primer mix, Distilled water(DNase free)
HSV1 Forward: ATCCTCGCTTTAGGAACAACT
HSV1 Reverse: CCAACTGCCCCCTTATCTA
HSV2 Forward: CGAAGACAGCTGCGTTCCC
HSV2 Reverse: TTCGCTTCATCGCCACGAAG
Equipment
Conventional PCR (ex.Veriti® Thermal Cycler -> Applied Biosystems, USA)
DNA Electrophoresis (ex.MyGeldoc -> LabGenomics Co., South Korea )
3. Procedure
3. Procedure
3.1. DNA extraction
① Extract total DNA from human origin using a DNA extraction kit.
② The Extracted DNA can be used immediately for the PCR, in case of long-term preservation, should be keep into the freezer under the –20℃
③ The concentration of the extracted DNA shall be from 5 to 100 ng/uL, and a sample with a purity of 1.6 to 2.0 at the A260/A280 ratio was used.
3.2. PCR reaction process for two types of virus reaction
① Prepare a PCR mixture. The PCR mixed solution is prepared by mixing each reagent with the composition of following table based on one sample. At this time, the amount of each reagent used should be calculated according to the number of reactions of the sample including the control (positive controls and negative controls) group.
② the prepared PCR mixture is lightly mixed about 5 times, or vortexed, and then centrifuged lightly.
③ Pour the PCR mixture 17 uL in to the PCR tube(after pouring, immediately close the lid to prevent contamination).
④ Template DNA 3 uL extracted from clinical samples, is added into the tube (positive control DNA provided in the positive control tube and DW in the negative control tube).
⑤ Each mixed solution tube is centrifuged for 30 seconds and the put into a PCR device to react as follows.
4. Results
4. Results
5. Precautions
5. Precautions
① Pay attention to pipetting so that DNA or PCR reagents do not contaminated during the experiment.
② Be careful not to make mistake in temperature and/or reagent amount during the experimental method.