[PCR]#2 K562 DNA amplification detection experiment

관리자
14 Jul 2021
Views 2501

Contents

1.Introduction

2.Materials and equipment

3.Procedure

4.Results

5.Precautions

6.References

1. Introduction


1. Introduction

- Perform DNA isolation from K562 cell line, and conduct DNA amplification and detection using PCR from the isolated DNA.

- Through this experiment, DNA isolation techniques and the applications of each extraction reagent can be learned

2. Materials and equipment


2. Materials and equipment

Materials

1) DNA extraction reagent

ReagentRole
AVL bufferAs a cell lysis buffer (Qiagen, Germany), it enables cell lysis (decomposition and dissolution).
Proteinase KDegrades unnecessary residual proteins from the lysed cell
100% EthanolDNA condensation, precipitation to facilitate beads binding.
MagAttract Suspension G (Beads)As a magnetic bead solution, (Qiagen, Germany) it allows the lysed DNA from the cell to be collected and attached to a surface.
AW1 buffer, AW2 bufferAs a washing buffer, (Qiagen, Germany) it allows unnecessary particle to be washed away from the DNA attached to the beads.
AE bufferAs an elution buffer, (Qiagen, Germany) it washes away the DNA from the beads at the final step of the experiment.


2) PCR reagent

DNA Polymerase 2X Master mix, Primer set、K562 DNA, dH2O, DNA Ladder(100bp)


  • Sequence information of the primer used in this experiment (refer to the article)

F: TCAGTATGTGACTTGGATTG

R: GATAAATACATAGGATGGATGG


Equipment

Conventional PCR (ex.DuxCycler- Biomedux, South Korea)

DNA Electrophoresis (ex.DuxGeldoc- Biomedux, South Korea)

3. Procedure


3. Procedure

1) DNA extraction (refer to QIAamp DNA kit)

① Add 20uL of Proteinase K to 200uL of Sample

② Add 25uL of MagAttract Suspension G(beads) to 200uL of 100% Ethanol preparing according to the number of samples

③ Add 200uL of AVL buffer into tube ① and vortex it for 15-30 seconds

④ Add tube ②’s reagents (100% ethanol + beads) into tube ③ and vortex it for 15-30 seconds

⑤ Collect beads in the sample for 1-2 minutes using a magnet and discard the solution.

⑥ Add 500mL of AW1 buffer and vortex it for 15-30 seconds.

⑦ Collect beads in the sample for 1-2 minutes using a magnet and discard the solution.

⑧ Add 500mL of AW2 buffer and vortex it for 15-30 seconds.

⑨ Collect beads in the sample for 1-2 minutes using a magnet and throw the solution.

⑩ Dry for 1-2 minutes with the cap of sample open.

⑪ Add 500mL of AE buffer, vortex it for 15-30 seconds, and wait for 1 minute at room temperature.

⑫ Attract beads in the sample for 1-2 minutes using a magnet and collect the *solution.


2) PCR sample reagent composition


SampleNC
2X Master Mix10 uL10 uL
Primer Set1 uL1 uL
K562 DNA6 uL-
dH2O3 uL9 uL
Total20 uL20 uL


3) Set up the device according to the PCR conditions

StageTemperatureTimeCycles
Pre-denaturation95℃05:001
Denaturation95℃00:3035*
Annealing55℃*00:30
Extension72℃01:00
Final Extension72℃05:001

4℃

There is a Master mix to use for each experiment. Each Master mix has a recommended temperature, time, and the number of cycles. You will experiment within these ranges. The conditions are determined according to the influencing factors, such as the size of the DNA for the experiment or the length of the primer.


4) After PCR is completed, check the amplified PCR product by using agarose gel electrophoresis

4. Results


4. Results

f7467388e8e43.jpeg(▲Image: DuxGeldoc - Biomedux, South Korea)

Lane
M100bp DNA Ladder
1K562 DNA (116bp)
2Negative Control

5. Precautions


5. Precautions

1) Be careful not to contaminate DNA or PCR reagents during the experiment.

2) Be careful not to make a mistake in the PCR temperature or amount of reagents during the experiment.

6. References


6. References (Attached)


#K562 DNA #DNA Extraction #Conventianal PCR



ad0009d7fcc40.png



2 0